Ads-728

Ads-728

Psicología

Astrofísica

Genética

Neurociencia

» » Una breve historia del genoma humano (1)

Referencia: NewScientist.com .
Autor: Michael Le Page, 17 de septiembre 2012

Desde las primeras células hasta los albores de nuestra especie, un viaje relámpago a través de 3 mil millones de años de evolución.

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA
GCGTATATTAAAGTTGCTGCAGTTAAAAAG

Parece un galimatías, pero esta secuencia de ADN es realmente notable. Está presente en todas las células de tu cuerpo, en tu gato, en tu perro, en el pescado de tu plato, en las abejas y las mariposas en tu jardín y en las bacterias en tu intestino. De hecho, donde quiera que se encuentre vida en la Tierra, desde los hirivientes respiraderos en las profundidades bajo el mar a las bacterias congeladas de las nubes altas por encima del planeta, en todos ellos se encuentra esta secuencia. Incluso se puede encontrar en algunas cosas que no están técnicamente vivas, como los virus gigantes conocidos como mimivirus.

Esta secuencia está tan extendida porque ha evolucionado de un ancestro común a toda la vida, y desde entonces sigue llevando a cabo un proceso crucial, sin apenas cambiar. Dicho de otra manera, hay una parte de tu ADN que tiene la inimaginable antigüedad de 3 mil millones años, y a pasado hasta ti en una cadena ininterrumpida de tus trillones de antepasados.

Otras pequeñas partes de su ADN son completamente nuevas. Tiene alrededor de 100 mutaciones en tu genoma que no están presentes en tu madre ni en tu padre, y que van desde el cambio de una o dos letras a la pérdida o ganancia de grandes trozos de ADN.

Podemos afirmar que estos trocitos de nuestro ADN son viejos o nuevos mediante la comparación de los genomas. Comparando el tuyo con el de tu hermano o hermana, por ejemplo, se revelan las nuevas mutaciones. Y en contraste, los genomas de la gente y de los animales revelan cambios mucho mayores.

Nuestros genomas, pues, no son únicamente recetas para fabricar gente. Son grabaciones históricas de la vida. Y dado que nuestros genomas son tan vastos, y consisten en más de 6 mil millones de letras de ADN, lo suficiente para hacer una pila de libros de decenas de metros de altura, que registran nuestro pasado con extraordinario detalle. Nos permiten rastrear nuestra evolución desde los albores de la vida hasta el presente.

Si bien no hemos hecho más que empezar a descifrar estas grabaciones, ya hemos descubierto que nuestros antepasados ​​no sólo se enfrentaron a una dura lucha por la supervivencia en un mundo rojo de dientes y garras. También sucedieron batallas épicas que acontecieron en nuestro genoma, batallas que transformaron la forma en que funciona nuestro genoma y que, finalmente, nos hacen ser lo que somos en la actualidad.

El ancestro universal

Al principio lo que existía era el ARN. Esta polifacética molécula puede almacenar información y catalizar reacciones, lo que significa que algunos ARN pueden multiplicarse. Tan pronto como una molécula de ARN, o un conjunto de moléculas, comenzó replicarse a sí misma, nació el primer genoma.

La desventaja del ARN es que no es particularmente estable, de modo que pronto cambió a almacenar la información en una molécula, con una cadena principal química ligeramente diferente, aunque con menos probabilidad de romperse, el ADN. Como las proteínas también sustituyen al ARN como catalizadores, van dejando al ARN relegado al papel de intermediario. El ADN conserva las recetas para fabricar proteínas, enviando las copias de ARN de las recetas a la maquinaria de hacer proteínas.

En nuestro genoma permanecen muchos vestigios del antiguo mundo dominado por el ARN. Esta ubicua secuencia del principio de este artículo, por ejemplo, codifica parte de una enzima del ARN que aún desempeña un papel clave en la síntesis de proteínas.

Hace alrededor de 3,5 mil millones de años, una entidad viviente pudo evolucionar gracias a un genoma que consistía en recetas para hacer ARN y proteínas, el último antepasado universal común a toda vida. Con confianza podemos rastrear al menos 100 genes hasta regresar a LUCA, apunta Eugene Koonin, del Instituto Nacional de Salud en Bethesda, Maryland, que estudia la evolución de la vida, y LUCA, probablemente, tenía más de 1.000 genes en total.

La maquinaria central de LUCA todavía se halla en toda la vida de hoy, incluida la producción de proteínas. Sin embargo, pudo haber sido muy diferente de la vida tal como la conocemos hoy en día. Algunos investigadores creen que LUCA no era en absoluto una membrana celular separada y enlazada a la célula, sino algo así como una mezcla de elementos víricos replicantes dentro de algún compartimento no vivo, como pueden ser los poros de los resperidaderos alcalinos hidrotermales.

División y reunión

Un posible escenario para la siguiente etapa es que subconjuntos de tipo vírico de LUCA elementos se separaron en dos ocasiones, adquirieron membranas celulares y se convirtieron en células simples. Esto explicaría por qué hay dos tipos de células simples, las bacterias y las arqueas, cada uno con una membrana celular completamente diferente. "Es una hipótesis muy atractiva", señala Koonin. Lo cierto es que la vida se dividió en dos grandes ramas muy pronto.

Las bacterias y arqueas desarrollaron una maquinaria molecular asombrosa que transformó el planeta, pero seguían siendo poco más que pequeñas bolsas de productos químicos. No fue hasta que un evento extraordinario reunió a las dos grandes ramas de la vida, que pudieron surgir las células complejas o eucariotas, un evento que transformó el genoma y allanó el camino hacia la evolución de los primeros animales.

Hace alrededor de mil millones de años, una bacteria terminó dentro de una arquea. En lugar de matarse una a otra, establecieron una relación simbiótica donde los descendientes de la bacteria evolucionaron gradualmente hasta asumir un papel crucial: se convirtieron en mitocondrias, esas fábricas energéticas dentro de las células que nos proporcionan nuestra energía.

Sin esta unión, la vida compleja jamás habría evolucionado. Tendemos a asumir que es natural que los organismos simples se conviertan en más complejos, pero las bacterias y las arqueas individuales nunca han evolucionado más allá de un cierto nivel de complejidad. ¿Por qué?

Según Nick Lane, del University College de Londres, es porque se topan con la barrera energética. Todos los organismos simples generan energía a partir de sus membranas celulares. Conforme se hacen más grandes, la relación del área de superficie respecto al volumen cae, haciendo más difícil la producción de suficiente energía. El resultado es que las células simples permanecen pequeñas, y las células pequeñas no tienen espacio para grandes genomas. Las mitocondrias eliminaron esta barrera, proporcionando fuentes de energía modulares y autónomas. Las células podrían entonces hacerse más grandes, simplemente produciendo más mitocondrias, lo que les permite ampliar sus genomas y la capacidad de almacenamiento de información.

Además de liberar las células de esta restricción energética, el ancestro de la mitocondria fue también la fuente de hasta tres cuartas partes de nuestros genes. La bacteria original, que probablemente tenía más o menos 3.000 genes, con el tiempo fue perdiendo o transfiriendo la mayoría al genoma principal, dejando a las mitocondrias modernas con tan sólo un puñado de genes.

A pesar de las evidentes ventajas, la forja de esta alianza era muy peligrosa. En particular, el genoma de la mitocondria ancestral estaba ++infestado con piezas de ADN parasitario, o transposones, que no hicían nada excepto crear copias de sí mismos. A veces aterrizaba en medio de los genes, dejando grandes trozos de ADN irrelevante conocidos como intrones. Es el equivalente de meter una receta de sopa en medio de una receta de pastel.

Sin embargo, el resultado no siempre fue una receta para el desastre, debido a que estos intrones son de "auto-empalme": después de que se hiciera una copia del ARN, el primer paso para el proceso de fabricación de proteínas, se autorecortaban. Esto, no obstante, siempre sucedía, por lo que su presencia era una desventaja. La mayoría de las bacterias no tienen intrones en los genes, ya que en las grandes poblaciones con mucha competencia entre los individuos, la selección natural es fuerte y las elimina. Pero la población de la eucariota ancestral era muy pequeña, así que la selección era débil. Los parásitos genéticos que llegaron con el ancestro de la mitocondria empezaron a replicarse a lo loco, ensuciando el genoma principal con cientos de intrones.

Hoy en día, cada uno de nuestros genes contiene normalmente alrededor de ocho intrones, muchos de los cuales se remontan a las primeras eucariotas, nuestros antepasados ​​nunca consiguieron deshacerse de la mayoría de ellos. En vez de eso, desarrollaron formas de tratar con ellos que alteraba la estructura de los genes y la forma en que las células se reproducen. Una de ellas fue el sexo.


- Primera Parte (1) - Segunda Parte (2) -
- Imagen: www.icsia.net .
..

«
Next
Entrada más reciente
»
Previous
Entrada antigua
Editor del blog Pedro Donaire

Filosofía

Educación

Deporte

Tecnología

Materiales